Puro-TTL-wt-TTF-1
(Plasmid #67657)

• Purpose: To create a dox-on inducible expression of human wt-TTF-1 cDNA in cells
• Depositing Lab: David Mu
• Publication: Rice et al J Biol Chem. 2013 Jun 7;288(23):16348-60. doi: 10.1074/jbc.M113.474643. Epub 2013 Apr 26.

Backbone

• Vector backbone: Puro-TTL
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 6602
• Total vector size (bp): 7718
• Modifications to backbone: TTF-1 insert cloned into the Xho I site
• Vector type: Retroviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): XL1 Blue
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Thyroid Transcription Factor 1
• Alt name: TTF-1
• Alt name: NKX2-1
• Alt name: TTF1 or TITF1
• Species: H. sapiens (human)
• Insert Size (bp): 1116
• GenBank ID: NM_003317
• Entrez Gene: NKX2-1 (a.k.a. BCH, BHC, NK-2, NKX2.1, NKX2A, NMTC1, T/EBP, TEBP, TITF1, TTF-1, TTF1)
• Tag / Fusion Protein:
  • N/A (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Xho I (not destroyed)
• 3′ cloning site: Xho I (not destroyed)
• 5′ sequencing primer: AATTAATTCGAGCTCGGTACCCGGGG
• 3′ sequencing primer: CAGACTGCCTTGGGAAAAGCGCC

Resource Information

• Supplemental Documents:
  • More info about the deposited plasmid

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry