Skip to main content
Addgene

pcDNA3.1(+)MBII-85-5'/3'ss mut
(Plasmid #67645)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 67645 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pcDNA3.1(+)
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    MBII85 snoRNA
  • Species
    M. musculus (mouse)
  • Mutation
    5' and 3' splice sites mutations

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer GGTTGCATTCCCTTTCCAGTA
  • 3′ sequencing primer CATTTAACTCAGGTGACCT
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3.1(+)MBII-85-5'/3'ss mut was a gift from Stefan Stamm (Addgene plasmid # 67645 ; http://n2t.net/addgene:67645 ; RRID:Addgene_67645)

  • For your References section:

    SNORD116 and SNORD115 change expression of multiple genes and modify each other's activity. Falaleeva M, Surface J, Shen M, de la Grange P, Stamm S. Gene. 2015 Jul 26. pii: S0378-1119(15)00848-3. doi: 10.1016/j.gene.2015.07.023. 10.1016/j.gene.2015.07.023 PubMed 26220404
Related items:
Commonly requested with: