AAV-CMV-SOD2-2A-Catalase-WPRE
(Plasmid #67635)

• Purpose: AAV vector expressing both SOD2 and mitochondrial targeted Catalase
• Depositing Lab: Connie Cepko
• Publication: Xiong et al J Clin Invest. 2015 Apr;125(4):1433-45. doi: 10.1172/JCI79735. Epub 2015 Mar 23.

Backbone

• Vector backbone: AAV-MCS8
• Backbone manufacturer: Jeng-Shin Lee, Harvard University
• Total vector size (bp): 8516
• Vector type: AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: SOD-2A-Catalase
• Species: M. musculus (mouse)
• Insert Size (bp): 2361
• Mutation: Deleted the Peroxisome Targeting Signal from Catalase and added the mitochondrial targeting sequence to the N-terminus of catalase
• Entrez Gene: Sod2 (a.k.a. MnSOD, Sod-2)
• Entrez Gene: Cat (a.k.a. 2210418N07, Ca, Cas, Cas-1, Cas1, Cs-, Cs-1)
• Promoter: CMV

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: tattggctcatgtccaacat
• 3′ sequencing primer: aatttcacaaataaagcact

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry