-
PurposeAAV vector expressing GFP
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 67634 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneAAV
-
Backbone manufacturerJeng-Shin Lee, Harvard University
- Total vector size (bp) 6940
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameGFP
-
Insert Size (bp)720
- Promoter CMV
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer tattggctcatgtccaacat
- 3′ sequencing primer ataagacaacagagacaact (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byObtained from Harvard plasmid center, cloned by Jeng-Shin Lee.
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAV-CMV-GFP was a gift from Connie Cepko (Addgene plasmid # 67634 ; http://n2t.net/addgene:67634 ; RRID:Addgene_67634) -
For your References section:
NRF2 promotes neuronal survival in neurodegeneration and acute nerve damage. Xiong W, MacColl Garfinkel AE, Li Y, Benowitz LI, Cepko CL. J Clin Invest. 2015 Apr;125(4):1433-45. doi: 10.1172/JCI79735. Epub 2015 Mar 23. 10.1172/JCI79735 PubMed 25798616