miR-141 reporter
(Plasmid
#67632)
-
PurposeTo quantify miR-141 function
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 67632 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepsiCHECK-2
- Backbone size w/o insert (bp) 6273
-
Vector typeLuciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert name2 binding sites for miR-141
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)63
- Promoter SV40
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer GCTGAAGAACGAGCAGTAAT
- 3′ sequencing primer GTCAGACAAACCCTAACCAC (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
miR-141 reporter was a gift from Judy Lieberman (Addgene plasmid # 67632 ; http://n2t.net/addgene:67632 ; RRID:Addgene_67632) -
For your References section:
miR-200-containing extracellular vesicles promote breast cancer cell metastasis. Le MT, Hamar P, Guo C, Basar E, Perdigao-Henriques R, Balaj L, Lieberman J. J Clin Invest. 2014 Dec;124(12):5109-28. doi: 10.1172/JCI75695. Epub 2014 Nov 17. 10.1172/JCI75695 PubMed 25401471