Lenti-sgNeo/Cre
(Plasmid
#67594)
-
PurposeExpresses an Neomycin-targeting gRNA and Cre-recombinase
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 67594 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepLL3.3
- Total vector size (bp) 7762
-
Vector typeMammalian Expression, Mouse Targeting, Lentiviral, Cre/Lox, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namesgNeo
-
gRNA/shRNA sequenceTCATGGCTGATGCAATGCGG
-
SpeciesM. musculus (mouse)
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SbfI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer GGTACAGTGCAGGGGAAAGA (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Lenti-sgNeo/Cre was a gift from Monte Winslow (Addgene plasmid # 67594 ; http://n2t.net/addgene:67594 ; RRID:Addgene_67594) -
For your References section:
Pancreatic cancer modeling using retrograde viral vector delivery and in vivo CRISPR/Cas9-mediated somatic genome editing. Chiou SH, Winters IP, Wang J, Naranjo S, Dudgeon C, Tamburini FB, Brady JJ, Yang D, Gruner BM, Chuang CH, Caswell DR, Zeng H, Chu P, Kim GE, Carpizo DR, Kim SK, Winslow MM. Genes Dev. 2015 Jul 15;29(14):1576-85. doi: 10.1101/gad.264861.115. Epub 2015 Jul 15. 10.1101/gad.264861.115 PubMed 26178787