Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pUASt- Crb intraGFP
(Plasmid #67525)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 67525 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pUAST
  • Backbone size w/o insert (bp) 8904
  • Vector type
    Insect Expression ; Drosophila

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    crumbs
  • Species
    D. melanogaster (fly)
  • Insert Size (bp)
    1379
  • Mutation
    aa97-2103 deleted (extracellular domain)
  • Entrez Gene
    crb (a.k.a. Dmel_CG6383, 0509/20, 1384/04, CG6383, CRB, CT19912, Crb, Crbs, Crumbs, DmCrb, Dmel\CG6383, crumb, far, l(3)07207, l(3)S050920, l(3)S058104, l(3)j1B5)
  • Promoter hsp70
  • Tag / Fusion Protein
    • GFP

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer hsp70-F (GAGCGCCGGAGTATAAATAGAG)
  • 3′ sequencing primer SV40pA-R
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Untagged pUASt- Crb intra from Elisabeth Knust lab

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The plasmid contains part of the 5' cDNA of Crb and the 3' part that brings the transmembrane and the intracellular domains of the protein together. The BglII restriction site links the 5' and 3' regions of the cDNA, meaning that the majority of the extracellular part of the Crb protein is missing. The fragment also contains the 5' and 3' UTR regions. BglII restriction site was used to clone a GFP fragment. GFP is inserted between aa 96 and 2122 of crb. Crb contains K89E mutation which does not affect plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pUASt- Crb intraGFP was a gift from Elisabeth Knust & Marta Llimargas Casanova (Addgene plasmid # 67525 ; http://n2t.net/addgene:67525 ; RRID:Addgene_67525)