Skip to main content
Addgene

1000.pCCLsin.cPPT.hPGK.Brn2.MIRT124_x4 Xma_lost.WPRE
(Plasmid #67295)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 67295 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCCL-cppt-PGK-MIRT124_x4 Xma_lost.WPRE
  • Backbone size w/o insert (bp) 7139
  • Modifications to backbone
    4x miR-124.T sequences (taaggcacgcggtgaatgcc) cloned downstream of WPRE
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Brn2
  • Alt name
    Pou3f2
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1369
  • Entrez Gene
    Pou3f2 (a.k.a. 9430075J19Rik, A230098E07Rik, Brn-2, Brn2, OTF-7, Otf7, oct-7)
  • Promoter PGK

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer ggagcgcacgtcgg
  • 3′ sequencing primer cagcaaccaggatttatacaagg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    1000.pCCLsin.cPPT.hPGK.Brn2.MIRT124_x4 Xma_lost.WPRE was a gift from Malin Parmar (Addgene plasmid # 67295 ; http://n2t.net/addgene:67295 ; RRID:Addgene_67295)
  • For your References section:

    Direct neural conversion from human fibroblasts using self-regulating and nonintegrating viral vectors. Lau S, Rylander Ottosson D, Jakobsson J, Parmar M. Cell Rep. 2014 Dec 11;9(5):1673-80. doi: 10.1016/j.celrep.2014.11.017. Epub 2014 Dec 4. 10.1016/j.celrep.2014.11.017 PubMed 25482564