LIR-wtloxP-TRE-CAG-Frt-red-puro-3xPA-Frt-GFP(mVenus)-KrasG12D-cMyc-SV40LT-IRES-KRABoff-PA-TRE-loxP257-RIR
(Plasmid #67277)

• Purpose: inducbile color change and cancer regulation: FlpO recombinase dependent expression of KrasG12D cMyc and SV40 large T antigen with doxycycline inducible downregulation through tetKRAB system.
• Depositing Lab: Jannik Elverløv-Jakobsen
• Publication: Callesen et al Mol Oncol. 2017 Nov;11(11):1616-1629. doi: 10.1002/1878-0261.12136. Epub 2017 Oct 10.

Backbone

• Vector backbone: Amp
• Backbone size w/o insert (bp): 3000
• Total vector size (bp): 16500
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: first casette contain a red fluorescent protein (katushka) linked to puromycin resitance gene through an E2A site
• Insert Size (bp): 1500
• Promoter: CAG
• Tag / Fusion Protein:
  • red flourescent gene katushka linked to puro through a E2A site (N terminal on backbone)

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: PacI (unknown if destroyed)
• 3′ cloning site: Asis (unknown if destroyed)
• 5′ sequencing primer: gctggttgttgtgctgtctc
• 3′ sequencing primer: cagacccttgccctggtg

Gene/Insert 2

• Gene/Insert name: second cassette contains mVENUS-kras-cmyc-SV40LT-KRABoff
• Insert Size (bp): 5700
• Promoter: CAG
• Tag / Fusion Protein:
  • mTQ2 blue fluorescent (N terminal on backbone)

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: Asis (unknown if destroyed)
• 3′ cloning site: MluI (unknown if destroyed)
• 5′ sequencing primer: gatcacatggtcctgctg
• 3′ sequencing primer: acaccgaggagaatgtcaag

Resource Information

• Supplemental Documents:
  • TRE VKCS_KRAB med stopper kat_Puro plus ROX SV40PA_GOLD Global
• Articles Citing this Plasmid:
  • 3 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry