Frt-Atg-Hygro-CMV-green (mWasabi)-PA-F3
(Plasmid #67276)

• Purpose: RMCE donor plasmid for FlpO. the marker gene is green fluorescent (mWasabi) with PA
• Depositing Lab: Jannik Elverløv-Jakobsen
• Publication: Callesen et al PLoS One. 2016 Aug 19;11(8):e0161471. doi: 10.1371/journal.pone.0161471. eCollection 2016.

Backbone

• Vector backbone: Amp
• Backbone size w/o insert (bp): 2000
• Total vector size (bp): 6000
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: GFP (mWasabi)
• Insert Size (bp): 700
• Promoter: CMV
• Tag / Fusion Protein:
  • F3 (N terminal on backbone)

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: Nhe (unknown if destroyed)
• 3′ cloning site: XcmI (unknown if destroyed)
• 5′ sequencing primer: TCAACCTGGAGGTGAAGGAG
• 3′ sequencing primer: TCAAGACCATCTACAGGGCC

Gene/Insert 2

• Gene/Insert name: hygro
• Insert Size (bp): 1000
• Tag / Fusion Protein:
  • Frt (N terminal on backbone)

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: MfeI (unknown if destroyed)
• 3′ cloning site: MluI (unknown if destroyed)
• 5′ sequencing primer: GCCCAAAGCATCAGCTCATC
• 3′ sequencing primer: ATTTCGGCTCCAACAATGTC

Resource Information

• Supplemental Documents:
  • Pre gold donoer med samme wasabi som invitrogen donor
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry