Transposon-for RMCE_Sleeping Beauty_LIR-CAG-Frt-red(katushka)-P2A-Puro-F3-PA-RIR
(Plasmid #67275)

• Purpose: For sleeping beauty transposition and establishment of an recombinase mediated cassette exchange docking site. To make RMCE in cell line instead of flp in cell lines
• Depositing Lab: Jannik Elverløv-Jakobsen
• Publication: Callesen et al PLoS One. 2016 Aug 19;11(8):e0161471. doi: 10.1371/journal.pone.0161471. eCollection 2016.

Backbone

• Vector backbone: Amp
• Backbone size w/o insert (bp): 2000
• Total vector size (bp): 7000
• Vector type: Mammalian Expression
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: puromycin resistant gene
• Species: Synthetic
• Insert Size (bp): 700
• Promoter: CAG
• Tag / Fusion Protein:
  • linked to red flouresent protein gene (katushka) (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: AgeI (unknown if destroyed)
• 3′ cloning site: ClaI (unknown if destroyed)
• 5′ sequencing primer: tgggcttgtactcggtcata
• 3′ sequencing primer: aacagatggaaggcctcctg

Resource Information

• Supplemental Documents:
  • GOLD transposon! Sira, V5, CAG XI Puro + F3_PA + start-FRT-lidtKAT + RIR + LIR - wt loxp
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry