Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCMT-flp
(Plasmid #67274)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 67274 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pRham-flp-tetA
  • Backbone manufacturer
    Hossain el al (Mark Liles lab)
  • Backbone size w/o insert (bp) 3699
  • Total vector size (bp) 5813
  • Vector type
    Flp recombinase plasmid, temperature sensitive

Growth in Bacteria

  • Bacterial Resistance(s)
    Tetracycline, 10 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    E. coli SM10lambdapir
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    tetA, flp, repA101, oriR101
  • Insert Size (bp)
    5813
  • Promoter tetA promoter of plasmid pACYC184 origin
  • Tag / Fusion Protein
    • His-SUMO (flp) (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsaAI (destroyed during cloning)
  • 3′ cloning site AlwNI (destroyed during cloning)
  • 5′ sequencing primer CGCATTCACAGTTCTCCGCAAG
  • 3′ sequencing primer CGAATCATCGGAAGAAGCAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

conjugally transferable flp plasmid for unmarked mutagenesis pCMT-flp

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCMT-flp was a gift from Mark Liles (Addgene plasmid # 67274 ; http://n2t.net/addgene:67274 ; RRID:Addgene_67274)
  • For your References section:

    Genome modifications and cloning using a conjugally transferable recombineering system. Hossain MJ, Thurlow CM, Sun D, Nasrin S, Liles MR. Biotechnol Rep (Amst). 2015 Aug 28;8:24-35. doi: 10.1016/j.btre.2015.08.005. eCollection 2015 Dec. 10.1016/j.btre.2015.08.005 PubMed 28352570