Skip to main content

pMJH46
(Plasmid #67272)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 67272 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pKD46
  • Vector type
    Red Recombinase

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol and Ampicillin, 25 & 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    SM10lambdapir
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    traJ, cat, oriT
  • Promoter cat gene promoter from PGNS-BAC

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (destroyed during cloning)
  • 3′ cloning site NotI (destroyed during cloning)
  • 5′ sequencing primer CGTCTACTCCGTTACAA
  • 3′ sequencing primer AGTATGATCTCAATGGTTCG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Conjugally transferable red recombinase vector pMJH46

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMJH46 was a gift from Mark Liles (Addgene plasmid # 67272 ; http://n2t.net/addgene:67272 ; RRID:Addgene_67272)
  • For your References section:

    Genome modifications and cloning using a conjugally transferable recombineering system. Hossain MJ, Thurlow CM, Sun D, Nasrin S, Liles MR. Biotechnol Rep (Amst). 2015 Aug 28;8:24-35. doi: 10.1016/j.btre.2015.08.005. eCollection 2015 Dec. 10.1016/j.btre.2015.08.005 PubMed 28352570
Commonly requested with: