pp32ΔCT
(Plasmid
#67241)
-
Purposepp32(1-149) cloned into pProEX HTb
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 67241 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepProEX HTb
-
Backbone manufacturerlife technology
- Backbone size w/o insert (bp) 4779
- Total vector size (bp) 5226
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namepp32
-
Alt nameAnp32a
-
Alt nameacidic nuclear phosphoprotein 32 family member A
-
SpeciesH. sapiens (human)
-
Insert Size (bp)447
-
Mutationcontains amino acid residues 1-149
-
GenBank IDNM_006305
-
Entrez GeneANP32A (a.k.a. C15orf1, HPPCn, I1PP2A, LANP, MAPM, PHAP1, PHAPI, PP32)
-
Tag
/ Fusion Protein
- His (N terminal on backbone)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer AGCGGATAACAATTTCACACAGG
- 3′ sequencing primer ATCTTCTCTCATCCGCCAAAACAG (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pp32ΔCT was a gift from Cynthia Wolberger (Addgene plasmid # 67241 ; http://n2t.net/addgene:67241 ; RRID:Addgene_67241) -
For your References section:
The crystal structure of the tumor suppressor protein pp32 (Anp32a): structural insights into Anp32 family of proteins. Huyton T, Wolberger C. Protein Sci. 2007 Jul;16(7):1308-15. Epub 2007 Jun 13. 10.1110/ps.072803507 PubMed 17567741