pp32ΔCT
(Plasmid #67241)

• Purpose: pp32(1-149) cloned into pProEX HTb
• Depositing Lab: Cynthia Wolberger
• Publication: Huyton et al Protein Sci. 2007 Jul;16(7):1308-15. Epub 2007 Jun 13.

Backbone

• Vector backbone: pProEX HTb
• Backbone manufacturer: life technology
• Backbone size w/o insert (bp): 4779
• Total vector size (bp): 5226
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: pp32
• Alt name: Anp32a
• Alt name: acidic nuclear phosphoprotein 32 family member A
• Species: H. sapiens (human)
• Insert Size (bp): 447
• Mutation: contains amino acid residues 1-149
• GenBank ID: NM_006305
• Entrez Gene: ANP32A (a.k.a. C15orf1, HPPCn, I1PP2A, LANP, MAPM, PHAP1, PHAPI, PP32)
• Tag / Fusion Protein:
  • His (N terminal on backbone)

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: AGCGGATAACAATTTCACACAGG
• 3′ sequencing primer: ATCTTCTCTCATCCGCCAAAACAG

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry