-
PurposeCRISPaint universal donor for TagGFP2 fusion tagging
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 67166 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCRISPaint
-
Backbone manufacturerVeit Hornung group
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)DH10B
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTagGFP2
-
SpeciesSynthetic
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
please check ip situation
sequence with: TTCGCTATTACGCCAGCTGGCGA
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCRISPaint-TagGFP2 was a gift from Veit Hornung (Addgene plasmid # 67166 ; http://n2t.net/addgene:67166 ; RRID:Addgene_67166) -
For your References section:
CRISPaint allows modular base-specific gene tagging using a ligase-4-dependent mechanism. Schmid-Burgk JL, Honing K, Ebert TS, Hornung V. Nat Commun. 2016 Jul 28;7:12338. doi: 10.1038/ncomms12338. 10.1038/ncomms12338 PubMed 27465542