Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pBS/U6/RNAi SadBs shRNA mouse
(Plasmid #67152)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 67152 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pBS/U6
  • Backbone manufacturer
    Gift from Y. Shi, Harvard Medical School
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    BRSK1
  • gRNA/shRNA sequence
    GGAGAAGCTGTCGGAATCGG
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1032
  • Entrez Gene
    Brsk1 (a.k.a. Gm1100, SAD-B, SADB)
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site ApaI (destroyed during cloning)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer M13R
  • 3′ sequencing primer U6
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBS/U6/RNAi SadBs shRNA mouse was a gift from Maria Alvarado-Kristensson & Ana Carrera (Addgene plasmid # 67152 ; http://n2t.net/addgene:67152 ; RRID:Addgene_67152)
  • For your References section:

    SADB phosphorylation of gamma-tubulin regulates centrosome duplication. Alvarado-Kristensson M, Rodriguez MJ, Silio V, Valpuesta JM, Carrera AC. Nat Cell Biol. 2009 Sep;11(9):1081-92. doi: 10.1038/ncb1921. Epub 2009 Aug 2. 10.1038/ncb1921 PubMed 19648910