pMRXIP VPS16-GFP
(Plasmid #67023)

• Purpose: Human VPS16 ORF was inserted into pMRXIP GFP-N vector
• Depositing Lab: Noboru Mizushima
• Publication: Jiang et al Mol Biol Cell. 2014 Apr;25(8):1327-37. doi: 10.1091/mbc.E13-08-0447. Epub 2014 Feb 19.

Backbone

• Vector backbone: pMRXIP GFP-N
• Backbone manufacturer: Dr.Shoji Yamaoka of Tokyo Medical and Dental University
• Backbone size w/o insert (bp): 6600
• Total vector size (bp): 9120
• Vector type: Retroviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Homo sapiens vacuolar protein sorting 16 homolog (S. cerevisiae) (VPS16)
• Species: H. sapiens (human)
• Insert Size (bp): 2520
• Entrez Gene: VPS16 (a.k.a. DYT30, hVPS16)
• Promoter: CMV
• Tag / Fusion Protein:
  • GFP (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: ggtggaccatcctctagact
• 3′ sequencing primer: AAAAGACGGCAATATGGTGG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: It has the pMX backbone
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry