-
PurposeExpresses Opto-MOR in a Cre dependent manner
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 66847 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAAV
- Backbone size w/o insert (bp) 6330
- Total vector size (bp) 7448
-
Vector typeMammalian Expression, AAV, Cre/Lox
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameOpto Mu opioid receptor
-
Alt nameOMOR
-
Alt nameOpto-MOR
-
SpeciesR. norvegicus (rat)
-
Insert Size (bp)1118
- Promoter Ef1a
-
Tag
/ Fusion Protein
- eYFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site NheI (not destroyed)
- 5′ sequencing primer gcttatcgataatcaacctctgg
- 3′ sequencing primer GGT GAA CAG CTC CTC GCC CTT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-Ef1a-DIO-OMOR-eYFP was a gift from Michael Bruchas (Addgene plasmid # 66847 ; http://n2t.net/addgene:66847 ; RRID:Addgene_66847) -
For your References section:
Spatiotemporal control of opioid signaling and behavior. Siuda ER, Copits BA, Schmidt MJ, Baird MA, Al-Hasani R, Planer WJ, Funderburk SC, McCall JG, Gereau RW 4th, Bruchas MR. Neuron. 2015 May 20;86(4):923-35. doi: 10.1016/j.neuron.2015.03.066. Epub 2015 Apr 30. 10.1016/j.neuron.2015.03.066 PubMed 25937173