Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pET30Xa-SBL1(160E)
(Plasmid #66846)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 66846 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pET30Xa-LIC
  • Backbone manufacturer
    Novagen
  • Backbone size w/o insert (bp) 5444
  • Total vector size (bp) 7978
  • Modifications to backbone
    11 bp added after coding region: TAAACTAGTCATGGGGC
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    37C before induction, 30 deg for 14-16+ hrs after induction
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    soybean lipoxygenase-1
  • Alt name
    SBL1
  • Species
    Glycine max
  • Insert Size (bp)
    2517
  • Mutation
    S160E
  • GenBank ID
    GB_AAA33986.1
  • Entrez Gene
    LOC547694 (a.k.a. GLYMA_08G189200, LOX)
  • Entrez Gene
    NEWENTRY
  • Promoter T7lac
  • Tag / Fusion Protein
    • His-tag (N terminal on backbone)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer TCATCATTCTTCTGGTCTGG
  • 3′ sequencing primer TTGCCGACTCTCATTAGCC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Cloned ~1996 from green pods of plants grown using "organic" soybeans from Glacial Ridge Foods.
Brendan C. Maguire, Dissertation, Johns Hopkins University, 1999, UMI Microform: 9927119.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET30Xa-SBL1(160E) was a gift from Betty Gaffney (Addgene plasmid # 66846 ; http://n2t.net/addgene:66846 ; RRID:Addgene_66846)
  • For your References section:

    On the relationships of substrate orientation, hydrogen abstraction, and product stereochemistry in single and double dioxygenations by soybean lipoxygenase-1 and its Ala542Gly mutant. Coffa G, Imber AN, Maguire BC, Laxmikanthan G, Schneider C, Gaffney BJ, Brash AR. J Biol Chem. 2005 Nov 18;280(46):38756-66. Epub 2005 Sep 12. 10.1074/jbc.M504870200 PubMed 16157595