pET30Xa-SBL1(160E)
(Plasmid
#66846)
-
PurposeExpresses soybean lipoxygenase-1 S160E mutant with N-term Histag
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 66846 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepET30Xa-LIC
-
Backbone manufacturerNovagen
- Backbone size w/o insert (bp) 5444
- Total vector size (bp) 7978
-
Modifications to backbone11 bp added after coding region: TAAACTAGTCATGGGGC
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructions37C before induction, 30 deg for 14-16+ hrs after induction
-
Copy numberUnknown
Gene/Insert
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer TCATCATTCTTCTGGTCTGG
- 3′ sequencing primer TTGCCGACTCTCATTAGCC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Cloned ~1996 from green pods of plants grown using "organic" soybeans from Glacial Ridge Foods.
Brendan C. Maguire, Dissertation, Johns Hopkins University, 1999, UMI Microform: 9927119.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET30Xa-SBL1(160E) was a gift from Betty Gaffney (Addgene plasmid # 66846 ; http://n2t.net/addgene:66846 ; RRID:Addgene_66846) -
For your References section:
On the relationships of substrate orientation, hydrogen abstraction, and product stereochemistry in single and double dioxygenations by soybean lipoxygenase-1 and its Ala542Gly mutant. Coffa G, Imber AN, Maguire BC, Laxmikanthan G, Schneider C, Gaffney BJ, Brash AR. J Biol Chem. 2005 Nov 18;280(46):38756-66. Epub 2005 Sep 12. 10.1074/jbc.M504870200 PubMed 16157595