pDD282
(Plasmid #66823)

• Purpose: GFP^SEC^3xFlag vector with ccdB markers for cloning homology arms
• Depositing Lab: Bob Goldstein
• Publication: Dickinson et al Genetics. 2015 Jun 3. pii: genetics.115.178335.

Backbone

• Vector backbone: pUC19 (modified)
• Backbone size w/o insert (bp): 2600
• Total vector size (bp): 10500
• Modifications to backbone: Addition of ccdB markers to facilitate homology arm cloning
• Vector type: Worm Expression, Cre/Lox, CRISPR
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Turbo
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: GFP-C1^SEC^3xFlag
• Species: C. elegans (nematode), Synthetic
• Insert Size (bp): 6600
• Tags / Fusion Proteins:
  • C. elegans codon-optimized GFP
  • 3xFlag

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: M13 Forward (tgtaaaacgacggccagt)
• 3′ sequencing primer: M13 Reverse (caggaaacagctatgaccatg)

Resource Information

• Supplemental Documents:
  • Annotated Sequence (Genbank format)
• Addgene Notes:
  • Addgene Diagnostic Digest- SpeI, ClaI
  • Addgene Diagnostic Digest- EcoRI
• Articles Citing this Plasmid:
  • 36 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

IMPORTANT NOTE: The repeat regions in this plasmid make it susceptible to recombination. The depositing lab grows the plasmid at 30°C. You may also want to prep and digest multiple single colonies to verify that you have a clone that has not recombined.

Sequence note: The full sequence is based on Addgene NGS of our stock. There may be some slight but innocuous inconsistencies with the depositor's GenBank files. One discrepancy affects the sequence of the 3' arm reverse primer (Table P1 and Figure P1) from the associated publication. The first g from the 3' end is missing:[tcacacaggaaacagctatgaccatgttat] -> [tcacacaggaaacagctatgaccatttat]