P119 C-Check
(Plasmid #66817)

• Purpose: Dual-fluorescent surrogate reporter vector for in vitro functional assay of programable DNA nuclease and enrichment of genetically edited cells
• Depositing Lab: Yonglun Luo
• Publication: Zhou et al Cell Mol Life Sci. 2016 Jan 11.

Backbone

• Vector backbone: pCR8
• Backbone manufacturer: Invitrogen
• Backbone size w/o insert (bp): 2575
• Total vector size (bp): 7120
• Modifications to backbone: no
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Spectinomycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: truncated Enhanced Green Fluorescent Protein and asRED
• Alt name: EGFP, asRED
• Alt name: C-Check
• Species: Synthetic
• Insert Size (bp): 4545
• Promoter: PGK and CMV

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BsaI (destroyed during cloning)
• 3′ cloning site: BsmBI (destroyed during cloning)
• 5′ sequencing primer: TTGATGCCTGGCAGTTCCCT
• 3′ sequencing primer: CGAACCGAACAGGCTTATGT

Resource Information

• Supplemental Documents:
  • Annotated GenBank file
  • C-Check Cloning Protocol
  • C-Check Oligo Design Template
• Addgene Notes:
  • Addgene Restriction Digest
• Articles Citing this Plasmid:
  • 5 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry