-
PurposeIVT vector for Fluc mRNA
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 66812 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepUC19
- Backbone size w/o insert (bp) 1811
- Total vector size (bp) 4112
-
Vector typeLuciferase ; mRNA IVT
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameFirefly luciferase
-
Alt nameFluc
-
SpeciesPhotinus pyralis
-
Insert Size (bp)1650
- Promoter T7
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer TAATACGACTCACTATAGG
- 3′ sequencing primer CACCGCGGCTGTAAATGTTT (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTK305 was a gift from Ron Weiss (Addgene plasmid # 66812 ; http://n2t.net/addgene:66812 ; RRID:Addgene_66812) -
For your References section:
N-methylpseudouridine-incorporated mRNA outperforms pseudouridine-incorporated mRNA by providing enhanced protein expression and reduced immunogenicity in mammalian cell lines and mice. Andries O, Cafferty SM, De Smedt SC, Weiss R, Sanders NN, Kitada T. J Control Release. 2015 Sep 2. pii: S0168-3659(15)30094-8. doi: 10.1016/j.jconrel.2015.08.051. 10.1016/j.jconrel.2015.08.051 PubMed 26342664