-
Purpose2nd generation lentiviral transfer plasmid. Expresses the reverse tetracycline-controlled transactivator (rtTA) with hygromycin resistance
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 66810 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneN144
-
Backbone manufacturerHomemade
- Backbone size w/o insert (bp) 9091
- Total vector size (bp) 9838
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameReverse tetracycline-controlled transactivator
-
Alt namertTA
- Promoter Human EF1a
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer GGCACTTGATGTAATTCTCCTTG
- 3′ sequencing primer GTGGATGTGGAATGTGTGCGA (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
rtTA-N144 was a gift from Andrew Yoo (Addgene plasmid # 66810 ; http://n2t.net/addgene:66810 ; RRID:Addgene_66810) -
For your References section:
MicroRNA-based conversion of human fibroblasts into striatal medium spiny neurons. Richner M, Victor MB, Liu Y, Abernathy D, Yoo AS. Nat Protoc. 2015 Oct;10(10):1543-55. doi: 10.1038/nprot.2015.102. Epub 2015 Sep 17. 10.1038/nprot.2015.102 PubMed 26379228