-
Purpose2nd generation lentiviral transfer plasmid. Expresses mouse CTIP2 with blasticidin resistance
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 66808 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneN106
-
Backbone manufacturerHomemade
- Backbone size w/o insert (bp) 8465
- Total vector size (bp) 10904
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCTIP2 isoform b
-
Alt nameCTIP2
-
Alt nameBCL11B
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)3631
-
GenBank IDNM_021399.2 NP_067374.2
-
Entrez GeneBcl11b (a.k.a. 9130430L19Rik, B630002E05Rik, BCL-11B, Ctip2, Rit1)
- Promoter Human EF1a
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer GGCACTTGATGTAATTCTCCTTG
- 3′ sequencing primer GTGGATGTGGAATGTGTGCGA (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pmCTIP2-N106 was a gift from Andrew Yoo (Addgene plasmid # 66808 ; http://n2t.net/addgene:66808 ; RRID:Addgene_66808) -
For your References section:
MicroRNA-based conversion of human fibroblasts into striatal medium spiny neurons. Richner M, Victor MB, Liu Y, Abernathy D, Yoo AS. Nat Protoc. 2015 Oct;10(10):1543-55. doi: 10.1038/nprot.2015.102. Epub 2015 Sep 17. 10.1038/nprot.2015.102 PubMed 26379228