-
PurposeExpresses TetActivator protein under the control of the c-fos promoter for use in TetTaging
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 66794 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepUC
- Backbone size w/o insert (bp) 3600
- Total vector size (bp) 6673
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namecfos promoter linked to the tet activator gene
-
SpeciesSynthetic
-
Insert Size (bp)1945
-
Tag
/ Fusion Protein
- no
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site PacI (unknown if destroyed)
- 3′ cloning site NotI (unknown if destroyed)
- 5′ sequencing primer GACCATCTCCGAAATCCTACACG
- 3′ sequencing primer ACAAAGGCATTAAAGCAGCGTATCCACAT (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bycfos-tTA was taken from Addgene plasmid ID #: 34856
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-cFos-tTA-pA was a gift from William Wisden (Addgene plasmid # 66794 ; http://n2t.net/addgene:66794 ; RRID:Addgene_66794) -
For your References section:
Neuronal ensembles sufficient for recovery sleep and the sedative actions of alpha2 adrenergic agonists. Zhang Z, Ferretti V, Guntan I, Moro A, Steinberg EA, Ye Z, Zecharia AY, Yu X, Vyssotski AL, Brickley SG, Yustos R, Pillidge ZE, Harding EC, Wisden W, Franks NP. Nat Neurosci. 2015 Apr;18(4):553-61. doi: 10.1038/nn.3957. Epub 2015 Feb 23. 10.1038/nn.3957 PubMed 25706476