Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pcDNA5FRT-EF-Pdgfralpha-EGFPN D842V
(Plasmid #66789)

Full plasmid sequence is not available for this item.

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 66789 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pcDNA5FRT
  • Vector type
    Mammalian Expression
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    PDGFRalpha
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    4049
  • Mutation
    D842V (constitutively active)
  • GenBank ID
    NM_001083316.1
  • Entrez Gene
    Pdgfra (a.k.a. CD140a, Pdgfr-2)
  • Promoter EF1a
  • Tag / Fusion Protein
    • EGFP (C terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer EF-1a-F (TCAAGCCTCAGACAGTGGTTC)
  • 3′ sequencing primer BGH-rev
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA5FRT-EF-Pdgfralpha-EGFPN D842V was a gift from Lotte Pedersen (Addgene plasmid # 66789 ; http://n2t.net/addgene:66789 ; RRID:Addgene_66789)
  • For your References section:

    PDGFRbeta and oncogenic mutant PDGFRalpha D842V promote disassembly of primary cilia through a PLCgamma- and AURKA-dependent mechanism. Nielsen BS, Malinda RR, Schmid FM, Pedersen SF, Christensen ST, Pedersen LB. J Cell Sci. 2015 Oct 1;128(19):3543-9. doi: 10.1242/jcs.173559. Epub 2015 Aug 19. 10.1242/jcs.173559 PubMed 26290382