NmCitrine-PHdomain
(Plasmid #66783)

• Purpose: Expression of PIP2 binding protein in sea urchin embryos
• Depositing Lab: Amro Hamdoun
• Publication: Campanale et al Dev Dyn. 2014 Jul;243(7):917-27. doi: 10.1002/dvdy.24133. Epub 2014 Apr 30.

Backbone

• Vector backbone: pCS2+8
• Backbone manufacturer: Addgene Plasmid #3493, Gökirmak et al. 2012, JBC
• Backbone size w/o insert (bp): 4851
• Vector type: Mammalian Expression ; sea urchin, zebrafish, xenopus

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: PLCdelta
• Alt name: PLCD1
• Species: H. sapiens (human)
• Insert Size (bp): 529
• Mutation: only contains PH domain
• Entrez Gene: PLCD1 (a.k.a. NDNC3, PLC-III)
• Promoter: SP6
• Tag / Fusion Protein:
  • mCitrine (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: FseI (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: SP6
• 3′ sequencing primer: TGTTGTTAACTTGTTTATTGCAGCT

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Addgene plasmid 21179 was used for PH domain sequence

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry