Skip to main content
Addgene

JWW-2 human chimeric monoclonal antibody
(Plasmid #66749)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 66749 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pVitro-neo-mcs
  • Backbone manufacturer
    invivogen
  • Backbone size w/o insert (bp) 6295
  • Total vector size (bp) 8390
  • Modifications to backbone
    pVITRO1-MCS plasmids carry two elongation factor 1 alpha (EF-1α) promoters, from rat (rEF1) and mouse (mEF1) origins
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    JWW-2 Heavy Chain
  • Species
    H. sapiens (human), M. musculus (mouse)
  • Insert Size (bp)
    1401
  • Promoter mEF1

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglII (destroyed during cloning)
  • 3′ cloning site NheI (destroyed during cloning)
  • 5′ sequencing primer TTTTGAGCGGAGCTAATTCTCGGG
  • 3′ sequencing primer AAAAAACCTCCCACACCTCC
    • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    JWW-2 Light Chain
  • Species
    H. sapiens (human), M. musculus (mouse)
  • Insert Size (bp)
    708
  • Promoter rEF1

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (unknown if destroyed)
  • 3′ cloning site AvrII (destroyed during cloning)
  • 5′ sequencing primer GAGGCTAATTCTCAAGCCTC
  • 3′ sequencing primer TCTAGACCTGGAAAGACCAG
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    JWW-2 human chimeric monoclonal antibody was a gift from Richard Roden (Addgene plasmid # 66749 ; http://n2t.net/addgene:66749 ; RRID:Addgene_66749)

  • For your References section:

    Sero-epidemiology of HPV16 L2 and generation of papillomavirus L2-specific human chimeric monoclonal antibodies. Wang JW, Jagu S, Wu WH, Viscidi RP, Macgregor-Das A, Fogel JM, Kwak K, Daayana S, Kitchener H, Stern PL, Gravitt PE, Trimble CL, Roden RB. Clin Vaccine Immunol. 2015 May 13. pii: CVI.00799-14. 10.1128/CVI.00799-14 PubMed 25972404
Related items:
Commonly requested with: