Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pBa-MARK2-eGFP
(Plasmid #66706)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 66706 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pBa-eGFP
  • Backbone size w/o insert (bp) 6732
  • Total vector size (bp) 8967
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    MARK2
  • Alt name
    microtubule affinity-regulating kinase 2
  • Alt name
    MAP/microtubule affinity-regulating kinase 2
  • Alt name
    Serine/threonine-protein kinase MARK2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2235
  • GenBank ID
    NM_004954 NP_004945.4
  • Entrez Gene
    MARK2 (a.k.a. EMK-1, EMK1, PAR-1, Par-1b, Par1b)
  • Promoter chicken beta actin
  • Tag / Fusion Protein
    • eGFP (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BlnI-blunted on vector, PsiI on insert (destroyed during cloning)
  • 3′ cloning site BlnI-blunted on vector, PsiI on insert (destroyed during cloning)
  • 5′ sequencing primer TTCGGCTTCTGGCGTGTGAC
  • 3′ sequencing primer AGCTTGCCGGTGGTGCAGAT
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    From Addgene (Plasmid #23404 from William Hahn) which contained 2bp deletion causing a frame shift. This was repaired by PCR and Restriction sites: 5' ClaI and 3' Bsu36I. Both sites remain. Sequence of primer to verify repair 5'-AACCTCAAGGAGCTGCGGGAAC-3'
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

pBa vector is susceptable to recombination and should not be grown in fast growing bacteria or cloned using recombination.
XL 10-Gold, Stbl3, OmniMax2, DH5alpha, and XL 1-Blue are suitable growth strains.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBa-MARK2-eGFP was a gift from Gary Banker & Marvin Bentley (Addgene plasmid # 66706 ; http://n2t.net/addgene:66706 ; RRID:Addgene_66706)