pCX-Klf2
(Plasmid #66655)

• Purpose: For expression of mouse Klf2.
• Depositing Lab: Barak Cohen
• Publication: Fiore et al Genome Res. 2016 Jun;26(6):778-86. doi: 10.1101/gr.200733.115. Epub 2016 Apr 15.

Backbone

• Vector backbone: pCX
• Total vector size (bp): 5858
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Klf2
• Species: M. musculus (mouse)
• Insert Size (bp): 1065
• Entrez Gene: Klf2 (a.k.a. Lklf)
• Promoter: CAG

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: tttgtcccaaatctgtgcgg
• 3′ sequencing primer: gctcaaggggcttcatgatg

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Klf2 came from plasmid pMXs-ms-Klf2 (Addgene plasmid #50786).
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The backbone of the plasmid is pCX-OKS-2A (Addgene plasmid #19771).