pGL-Pou
(Plasmid
#66654)
-
PurposeParent vector used for inserting cis-regulatory elements (CREs) for CRE-seq in ES cells. Uses the Pou5f1 basal promoter and dsRed gene.
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 66654 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepGL4
-
Backbone manufacturerPromega
- Total vector size (bp) 3668
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namedsRed-Express2
-
SpeciesSynthetic
-
Insert Size (bp)674
- Promoter Mouse Pou5f1 basal promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NcoI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer TCATTACATCTGTGTGTTGGTTTTT
- 3′ sequencing primer CCCCCTGAACCTGAAACATA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGL-Pou was a gift from Barak Cohen (Addgene plasmid # 66654 ; http://n2t.net/addgene:66654 ; RRID:Addgene_66654) -
For your References section:
Interactions between pluripotency factors specify cis-regulation in embryonic stem cells. Fiore C, Cohen BA. Genome Res. 2016 Jun;26(6):778-86. doi: 10.1101/gr.200733.115. Epub 2016 Apr 15. 10.1101/gr.200733.115 PubMed 27197208
Map uploaded by the depositor.
