-
PurposeSpecific and conditional cell ablation of beta cells in the zebrafish pancreas
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 66593 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneI-Sce I element containing vector
-
Vector typezebrafish expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameInsulin promotor driving CFP-nitroreductase
-
Alt nameins:CFP-Eco.NfsB
-
SpeciesD. rerio (zebrafish); Aequorea victoria, E.coli
-
Insert Size (bp)3000
- Promoter Zebrafish Insulin promoter (approximately 1.2kb)
-
Tag
/ Fusion Protein
- CFP fused with N-terminus of nitroreductase (N terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer GCTATTCGTCCCAAAACATCTCCAC
- 3′ sequencing primer TAGCATCACAAATTTCACAAATAAAGC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
ins:CFP-NTR was a gift from Didier Stainier (Addgene plasmid # 66593 ; http://n2t.net/addgene:66593 ; RRID:Addgene_66593) -
For your References section:
Conditional targeted cell ablation in zebrafish: a new tool for regeneration studies. Curado S, Anderson RM, Jungblut B, Mumm J, Schroeter E, Stainier DY. Dev Dyn. 2007 Apr . 236(4):1025-35. 10.1002/dvdy.21100 PubMed 17326133
Map uploaded by the depositor.