pC13N-iCAG.copGFP
(Plasmid #66578)

• Purpose: CLYBL safe harbor gene targeting donor expressing CAG-driven copGFP, compatible with pZT-C13 TALENs
• Depositing Lab: Jizhong Zou
• Publication: Cerbini et al PLoS One. 2015 Jan 14;10(1):e0116032. doi: 10.1371/journal.pone.0116032. eCollection 2015.

Backbone

• Vector backbone: pC13N-iRMCE
• Backbone size w/o insert (bp): 10214
• Total vector size (bp): 10973
• Modifications to backbone: copGFP was cloned under CAG promoter
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: copGFP
• Species: Synthetic
• Insert Size (bp): 759
• Promoter: CAG

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BsrGI (not destroyed)
• 3′ cloning site: MluI (not destroyed)
• 5′ sequencing primer: gggcggggttcggcttctgg

Resource Information

• Articles Citing this Plasmid:
  • 5 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry