pETM6-vioABECD
(Plasmid
#66535)
-
PurposepETM6 vector containing vioA-vioB-vioE-vioC-vioD in monocistronic configuration with consensus promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 66535 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepETM6
- Backbone size w/o insert (bp) 5155
- Total vector size (bp) 13599
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameVioA
-
SpeciesPseudoalteromonas luteoviolacea
-
Insert Size (bp)1290
- Promoter Consensus T7
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer ATGTTAAATTTAGAGCATTCAG
- 3′ sequencing primer TCAAAGGTATACTACTTCTTTCAC (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameVioB
-
SpeciesPseudoalteromonas luteoviolacea
-
Insert Size (bp)3030
- Promoter Consensus T7
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer ATGAGTGTTTTAGATTTTCCTCG
- 3′ sequencing primer CTAACCTTCCTTTGAAAG (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nameVioE
-
SpeciesPseudoalteromonas luteoviolacea
-
Insert Size (bp)606
- Promoter Consensus T7
Cloning Information for Gene/Insert 3
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer ATGGAATTACGTAAAGTAGATAGAGTTCC
- 3′ sequencing primer TCAATTCCTATGAGAGAGAC (Common Sequencing Primers)
Gene/Insert 4
-
Gene/Insert nameVioC
-
SpeciesPseudoalteromonas luteoviolacea
-
Insert Size (bp)1290
- Promoter Consensus T7
Cloning Information for Gene/Insert 4
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer ATGAGTAAAATAATTATTGTTGGTGGTG
- 3′ sequencing primer TTAATTCATTCTCCCTATTTTGTAC (Common Sequencing Primers)
Gene/Insert 5
-
Gene/Insert nameVioD
-
SpeciesPseudoalteromonas luteoviolacea
-
Insert Size (bp)1122
- Promoter Consensus T7
Cloning Information for Gene/Insert 5
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer ATGAACATTTTAGTGATCGGG
- 3′ sequencing primer GAGTTAACGTTGCAGCGC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pETM6-vioABECD was a gift from Mattheos Koffas (Addgene plasmid # 66535 ; http://n2t.net/addgene:66535 ; RRID:Addgene_66535) -
For your References section:
ePathOptimize: A Combinatorial Approach for Transcriptional Balancing of Metabolic Pathways. Jones JA, Vernacchio VR, Lachance DM, Lebovich M, Fu L, Shirke AN, Schultz VL, Cress B, Linhardt RJ, Koffas MA. Sci Rep. 2015 Jun 11;5:11301. doi: 10.1038/srep11301. 10.1038/srep11301 PubMed 26062452