pETM6-H9-mCherry
(Plasmid
#66532)
-
PurposeExpresses mCherry under the control of Mutant T7 Promoter H9
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 66532 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepETM6
- Backbone size w/o insert (bp) 5155
- Total vector size (bp) 5866
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemCherry
-
SpeciesSynthetic
-
Insert Size (bp)711
-
MutationCodon Optimized for E. coli
- Promoter Mutant T7 Promoter - H9
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer cgagatcgatctcgatcccg
- 3′ sequencing primer GCT AGT TAT TGC TCA GCG G (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pETM6-H9-mCherry was a gift from Mattheos Koffas (Addgene plasmid # 66532 ; http://n2t.net/addgene:66532 ; RRID:Addgene_66532) -
For your References section:
ePathOptimize: A Combinatorial Approach for Transcriptional Balancing of Metabolic Pathways. Jones JA, Vernacchio VR, Lachance DM, Lebovich M, Fu L, Shirke AN, Schultz VL, Cress B, Linhardt RJ, Koffas MA. Sci Rep. 2015 Jun 11;5:11301. doi: 10.1038/srep11301. 10.1038/srep11301 PubMed 26062452