-
Purposeexpression of Cas9 in plants, cauliflower mosaic virus 35S promoter (P35S), Neo selection
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 66191 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCAMBIA1300
-
Backbone manufacturerCAMBIA
-
Vector typePlant Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)ccdB Survival
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCas9
-
SpeciesS. pyogenes
-
Mutationplant-codon optimized with higher GC contents (62.5%) in the 5’ region (400 bp) and 54.2% overall GC content
- Promoter cauliflower mosaic virus 35S promoter (P35S)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer M13pUC-Rev
- 3′ sequencing primer NOSterm-R attgccaaatgtttgaacga (Common Sequencing Primers)
Resource Information
-
Addgene Notes
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Accession # KR029112 A fragment containing a modified ccdB flanked by two BsaI sites was cloned into the vectors to produce the CRISPR/Cas9 binary vectors. This can be used for inserting sgRNA cassette.
Please see our published protocol for using these plasmids. Ma, X. and Liu, Y.-G. 2016. CRISPR/Cas9-based multiplex genome editing in monocot and dicot plants. Curr. Protoc. Mol. Biol. 115:31.6.1-31.6.21. http://onlinelibrary.wiley.com/doi/10.1002/cpmb.10/abstract doi: 10.1002/cpmb.10
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pYLCRISPR/Cas9P35S-N was a gift from Yao-Guang Liu (Addgene plasmid # 66191 ; http://n2t.net/addgene:66191 ; RRID:Addgene_66191) -
For your References section:
A robust CRISPR/Cas9 system for convenient, high-efficiency multiplex genome editing in monocot and dicot plants. Ma X, Zhang Q, Zhu Q, Liu W, Chen Y, Qiu R, Wang B, Yang Z, Li H, Lin Y, Xie Y, Shen R, Chen S, Wang Z, Chen Y, Guo J, Chen L, Zhao X, Dong Z, Liu YG. Mol Plant. 2015 Apr 24. pii: S1674-2052(15)00204-X. doi: 10.1016/j.molp.2015.04.007. 10.1016/j.molp.2015.04.007 PubMed 25917172