Skip to main content
Addgene

pYLCRISPR/Cas9P35S-B
(Plasmid #66190)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 66190 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCAMBIA1300
  • Backbone manufacturer
    CAMBIA
  • Vector type
    Plant Expression
  • Selectable markers
    Basta

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10F'
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Cas9
  • Species
    S. pyogenes
  • Mutation
    plant-codon optimized with higher GC contents (62.5%) in the 5’ region (400 bp) and 54.2% overall GC content
  • Promoter cauliflower mosaic virus 35S promoter (P35S)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer M13pUC-Rev
  • 3′ sequencing primer NOSterm-R attgccaaatgtttgaacga
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Accession # KR029113 A fragment containing a modified ccdB flanked by two BsaI sites was cloned into the vectors to produce the CRISPR/Cas9 binary vectors. This can be used for inserting sgRNA cassette.

Please see our published protocol for using these plasmids. Ma, X. and Liu, Y.-G. 2016. CRISPR/Cas9-based multiplex genome editing in monocot and dicot plants. Curr. Protoc. Mol. Biol. 115:31.6.1-31.6.21. http://onlinelibrary.wiley.com/doi/10.1002/cpmb.10/abstract doi: 10.1002/cpmb.10

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pYLCRISPR/Cas9P35S-B was a gift from Yao-Guang Liu (Addgene plasmid # 66190 ; http://n2t.net/addgene:66190 ; RRID:Addgene_66190)
  • For your References section:

    A robust CRISPR/Cas9 system for convenient, high-efficiency multiplex genome editing in monocot and dicot plants. Ma X, Zhang Q, Zhu Q, Liu W, Chen Y, Qiu R, Wang B, Yang Z, Li H, Lin Y, Xie Y, Shen R, Chen S, Wang Z, Chen Y, Guo J, Chen L, Zhao X, Dong Z, Liu YG. Mol Plant. 2015 Apr 24. pii: S1674-2052(15)00204-X. doi: 10.1016/j.molp.2015.04.007. 10.1016/j.molp.2015.04.007 PubMed 25917172