APEX2 - Actin in pEGFP
(Plasmid #66172)

• Purpose: APEX2 fused to the N-terminus of human beta actin
• Depositing Lab: Alice Ting
• Publication: Lam et al Nat Methods. 2014 Nov 24. doi: 10.1038/nmeth.3179.

Backbone

• Vector backbone: pEGFP
• Backbone manufacturer: Clonetech
• Backbone size w/o insert (bp): 3954
• Total vector size (bp): 5907
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): XL1 Blue
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: APEX2 - human beta Actin
• Species: H. sapiens (human), Synthetic
• Insert Size (bp): 1953
• Mutation: APEX2 contains 4 mutations relative to wt soybean APX: K14D, W41F, E112K, A134P
• Entrez Gene: ACTB (a.k.a. BKRNS, BNS, BRWS1, CSMH, DDS1, PS1TP5BP1, THC8)
• Promoter: CMV
• Tag / Fusion Protein:
  • Flag epitope tag (DYKDDDDK) (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: CMVf (CGCAAATGGGCGGTAGGCGTG)

Resource Information

• Articles Citing this Plasmid:
  • 4 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry