pGL4.10-VEGFprom(-950 to -700)
(Plasmid
#66133)
-
PurposeLuciferase-based reporter for VEGF promoter region (-950 to -700 bp)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 66133 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepGL4.10
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 4242
- Total vector size (bp) 4345
-
Vector typeLuciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)JM109
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameVascular Endothelial Growth Factor-A promoter region
-
Alt nameVEGF
-
Alt nameVEGFA
-
SpeciesH. sapiens (human)
-
Entrez GeneVEGFA (a.k.a. L-VEGF, MVCD1, VEGF, VPF)
- Promoter VEGF -950 to -700
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer TTAAGGTACCAAGCCCATTCCCTCTTTAGC
- 3′ sequencing primer TTAAAAGCTTAGGGACACACAGATCTATTGG (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGL4.10-VEGFprom(-950 to -700) was a gift from David Mu (Addgene plasmid # 66133 ; http://n2t.net/addgene:66133 ; RRID:Addgene_66133) -
For your References section:
Thyroid Transcription Factor 1 Reprograms Angiogenic Activities of Secretome. Wood LW, Cox NI, Phelps CA, Lai SC, Poddar A, Talbot C Jr, Mu D. Sci Rep. 2016 Feb 25;6:19857. doi: 10.1038/srep19857. 10.1038/srep19857 PubMed 26912193