pAD/CMV/V5-DEST-Rac1-2G
(Plasmid
#66112)
-
PurposeSecond generation Rac1 FRET biosensor for adenovirus production
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 66112 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAd/CMV/V5-DEST
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 36686
- Total vector size (bp) 37257
-
Vector typeMammalian Expression, Adenoviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameSecond generation Rac1 FRET biosensor
-
Alt nameRac1-2G
-
SpeciesSynthetic
-
Insert Size (bp)2576
- Promoter CMV
-
Tag
/ Fusion Protein
- His-Myc (N terminal on insert)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer ACCGAGGAGAGGGTTAGGGAT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAD/CMV/V5-DEST-Rac1-2G was a gift from Olivier Pertz (Addgene plasmid # 66112 ; http://n2t.net/addgene:66112 ; RRID:Addgene_66112) -
For your References section:
SrGAP2-Dependent Integration of Membrane Geometry and Slit-Robo-Repulsive Cues Regulates Fibroblast Contact Inhibition of Locomotion. Fritz RD, Menshykau D, Martin K, Reimann A, Pontelli V, Pertz O. Dev Cell. 2015 Sep 29. pii: S1534-5807(15)00582-1. doi: 10.1016/j.devcel.2015.09.002. 10.1016/j.devcel.2015.09.002 PubMed 26439400