AP324-3
(Plasmid
#66093)
-
Purposeco-expression of Cas9 and a sgRNA targeting 3'end of C.elegans K08F4.2
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 66093 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepDD162
-
Backbone manufacturerGoldstein lab Plasmid 47549
-
Vector typeWorm Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namesgRNA for APs6
-
gRNA/shRNA sequencecgcagcggtttccaaaatg
- Promoter U6
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer tatgaaatgcctacaccctctc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
From the depositor: Each positive clones had been sequenced for correct insertion of the sgRNA . However the PCR could have created some mutation in the plasmid backbone (containing also the Cas9 gene) and we didnt sequenced the full plasmid, therefore we recommend to use a mix of several positive clones. It is why we provide several clones containing the same sgRNA insert.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AP324-3 was a gift from Geraldine Seydoux (Addgene plasmid # 66093 ; http://n2t.net/addgene:66093 ; RRID:Addgene_66093) -
For your References section:
Scalable and versatile genome editing using linear DNAs with microhomology to Cas9 Sites in Caenorhabditis elegans. Paix A, Wang Y, Smith HE, Lee CY, Calidas D, Lu T, Smith J, Schmidt H, Krause MW, Seydoux G. Genetics. 2014 Dec;198(4):1347-56. doi: 10.1534/genetics.114.170423. Epub 2014 Sep 23. 10.1534/genetics.114.170423 PubMed 25249454