-
PurposeTribolium basal heat shock promoter driving Cas9
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 65959 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepSLfa[Tc-bhsp68::nlsEGFP]fa
- Backbone size w/o insert (bp) 4168
- Total vector size (bp) 8323
-
Vector typeInsect Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCas9
-
SpeciesS. pyogenes
-
Insert Size (bp)4155
- Promoter bhsp
-
Tag
/ Fusion Protein
- nuclear localization sequence (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (unknown if destroyed)
- 3′ cloning site Not1 (unknown if destroyed)
- 5′ sequencing primer TAACCGGTCGCCACCATGGATAAGAAATAC
- 3′ sequencing primer AAGCGGCCGCTCATCCTGCAGCTCCAC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byCas9 was cloned from Addgene MLM3613
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
An online tool to help oligo design for gRNAs is at http://www.averof-lab.org/tools/Tribolium_CRISPR.php
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p(bhsp68-Cas9) was a gift from Michalis Averof (Addgene plasmid # 65959 ; http://n2t.net/addgene:65959 ; RRID:Addgene_65959) -
For your References section:
Efficient CRISPR-mediated gene targeting and transgene replacement in the beetle Tribolium castaneum. Gilles AF, Schinko JB, Averof M. Development. 2015 Jul 9. pii: dev.125054. 10.1242/dev.125054 PubMed 26160901