pCH119
(Plasmid #65954)

• Purpose: Receptor integration for two-strain system
• Depositing Lab: Matthew Bennett
• Publication: Chen et al Science. 2015 Aug 28;349(6251):986-9. doi: 10.1126/science.aaa3794.

Backbone

• Vector backbone: pSC101

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol, 25 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): XL1 Blue
• Copy number: Low Copy

Gene/Insert 1

• Gene/Insert name: RhlR
• Insert Size (bp): 966
• Entrez Gene: rhlR (a.k.a. PA3477)
• Promoter: pTrc*

Cloning Information for Gene/Insert 1

• Cloning method: Unknown
• 5′ sequencing primer: agaaatactagtatgaggaatgacggaggctttttgc
• 3′ sequencing primer: accagaaagcttattagatgagacccagcgccgcg

Gene/Insert 2

• Gene/Insert name: CinR
• Insert Size (bp): 726
• GenBank ID: AF210630.1
• Promoter: pTrc*

Cloning Information for Gene/Insert 2

• Cloning method: Unknown
• 5′ sequencing primer: agaaatactagtatgattgagaatacctatagcgaaaagttcgag
• 3′ sequencing primer: gcgttcgagctctcagggattgatgatgcgcaattgaac

Resource Information

• Supplemental Documents:
  • annotated file

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Integrated into the attP site