Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pcDNA3.2-R5A-K6A C11orf83-V5
(Plasmid #65850)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 65850 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCDNA 3.2
  • Backbone manufacturer
    Life technologies
  • Total vector size (bp) 5832
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Mutated UQCC3
  • Alt name
    C11orf83
  • Species
    H. sapiens (human)
  • Mutation
    R5A-K6A
  • GenBank ID
    NM_001085372.2
  • Entrez Gene
    UQCC3 (a.k.a. C11orf83, CCDS41658.1, MC3DN9, UNQ655)
  • Tag / Fusion Protein
    • V5 (C terminal on insert)

Cloning Information

  • Cloning method TOPO Cloning
  • 5′ sequencing primer CACCATGGATTCCTTGCGGAAAATGCTGATCTC
  • 3′ sequencing primer CGGTGACCTCCCGCCGGCG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3.2-R5A-K6A C11orf83-V5 was a gift from Amos Bairoch (Addgene plasmid # 65850 ; http://n2t.net/addgene:65850 ; RRID:Addgene_65850)
  • For your References section:

    C11orf83, a mitochondrial cardiolipin-binding protein involved in bc1 complex assembly and supercomplex stabilization. Desmurs M, Foti M, Raemy E, Vaz FM, Martinou JC, Bairoch A, Lane L. Mol Cell Biol. 2015 Apr;35(7):1139-56. doi: 10.1128/MCB.01047-14. Epub 2015 Jan 20. 10.1128/MCB.01047-14 PubMed 25605331