Pflp-18::NGL-1::spGFP11
(Plasmid #65828)

• Purpose: For trans-synaptic labeling
• Depositing Labs: Cori Bargmann, Kang Shen
• Publication: Feinberg et al Neuron. 2008 Feb 7. 57(3):353-63.

Backbone

• Vector backbone: pSM
• Backbone manufacturer: C.I. Bargmann and S. MaCarroll
• Backbone size w/o insert (bp): 3500
• Total vector size (bp): 9194
• Vector type: Worm Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: NLG-1
• Alt name: NLG-1 cDNA
• Species: C. elegans (nematode)
• Insert Size (bp): 2610
• Mutation: N142S
• Entrez Gene: nlg-1 (a.k.a. CELE_C40C9.5)
• Promoter: Pflp-18
• Tag / Fusion Protein:
  • spGFP11 (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: PmeI (not destroyed)
• 5′ sequencing primer: GCCAAAGGACCCAAAGGTATG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Miri K. VanHoven made it originally, named as MVC12

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Mutation N142S does not affect plasmid function