pSMART-2,3-BDO1
(Plasmid #65816)

• Purpose: NADH Dependent 2,3-BDO Production Construct, Low Phosphate Dependent E. coli Expression
• Depositing Lab: Michael Lynch
• Publication: SUPERSEDE (unpublished)

Backbone

• Vector backbone: pSMART-HCKan (AF532107.1)
• Backbone manufacturer: Lucigen (Middleton, WI)
• Backbone size w/o insert (bp): 1800
• Total vector size (bp): 5364
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Top10
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: budA: α-acetolactate decarboxylase
• Alt name: budA
• Species: Synthetic; Enterobacter cloacae subsp. dissolvens SDM
• Insert Size (bp): 800
• Promoter: waaHp from E. coli as part of operon with budB and budC

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CAG TCC AGT TAC GCT GGA GTC
• 3′ sequencing primer: CGATGACCGATGTGCTG

Gene/Insert 2

• Gene/Insert name: budB: acetolactate synthase
• Alt name: budB
• Species: Synthetic; Enterobacter cloacae subsp. dissolvens SDM
• Insert Size (bp): 1700
• Promoter: waaHp from E. coli as part of operon with budA and budC

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: TCTCCAGTAACCAAATATGCG
• 3′ sequencing primer: TTTGCGCTGCATCCATTAC

Gene/Insert 3

• Gene/Insert name: budC: acetoin reductase
• Alt name: budC
• Species: Synthetic; Enterobacter cloacae subsp. dissolvens SDM
• Insert Size (bp): 750
• Promoter: waaHp from E. coli as part of operon with budA and budB

Cloning Information for Gene/Insert 3

• Cloning method: Gibson Cloning
• 5′ sequencing primer: TTTGCGCTGCATCCATTAC
• 3′ sequencing primer: GGT CAG GTA TGA TTT AA A TGG TCA GT

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry