pSMART-Mev1
(Plasmid #65815)

• Purpose: NADPH Dependent Mevalonic Acid Production Construct, Low Phosphate Dependent E. coli Expression
• Depositing Lab: Michael Lynch
• Publication: SUPERSEDE (unpublished)

Backbone

• Vector backbone: pSMART-HCKan (AF532107.1)
• Backbone manufacturer: Lucigen (Middleton, WI)
• Backbone size w/o insert (bp): 1800
• Total vector size (bp): 6275
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Top10
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: mvaE: bifunctional acetoacetyl-CoA thiolase, and NADPH dependent HMG-CoA reductase
• Alt name: mvaE
• Species: Synthetic; Enterococcus faecalis
• Insert Size (bp): 2400
• Promoter: insulated waaHp from E. coli

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CAG TCC AGT TAC GCT GGA GTC
• 3′ sequencing primer: AGAATGTTGCTGAAAAATACCACG

Gene/Insert 2

• Gene/Insert name: mvaS: hydroxymethylglutaryl-CoA synthase
• Alt name: mvaS
• Species: Synthetic; Enterococcus faecalis
• Insert Size (bp): 1100
• Promoter: insulated mipAp from E. coli

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CACACAACAAAGGCATTATGAATG
• 3′ sequencing primer: GGT CAG GTA TGA TTT AA A TGG TCA GT

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry