Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pcDNA3.1-CMV-CFP;UBC-Cre25nt
(Plasmid #65727)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 65727 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pcDNA3.1
  • Total vector size (bp) 8225
  • Vector type
    Mammalian Expression, Cre/Lox
  • Selectable markers
    Zeocin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    CMV promoter driving CFP expression
  • Promoter CMV

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site Mlul (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer GCT GCT TCG CGA TGT ACG G
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    UBC promoter driving Cre-25nt expression
  • Promoter UBC

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRl (not destroyed)
  • 3′ cloning site Xbal (not destroyed)
  • 5′ sequencing primer GCCACTCCCACTGTCCTTTC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3.1-CMV-CFP;UBC-Cre25nt was a gift from Jacco van Rheenen (Addgene plasmid # 65727 ; http://n2t.net/addgene:65727 ; RRID:Addgene_65727)
  • For your References section:

    In Vivo imaging reveals extracellular vesicle-mediated phenocopying of metastatic behavior. Zomer A, Maynard C, Verweij FJ, Kamermans A, Schafer R, Beerling E, Schiffelers RM, de Wit E, Berenguer J, Ellenbroek SI, Wurdinger T, Pegtel DM, van Rheenen J. Cell. 2015 May 21;161(5):1046-57. doi: 10.1016/j.cell.2015.04.042. 10.1016/j.cell.2015.04.042 PubMed 26000481