pcDNA3.1-CMV-CFP;UBC-Cre25nt
(Plasmid #65727)

• Purpose: Expresses Cre recombinase with a 25 nucleotide extracellular vesicle targeting sequence under the UBC promotor and CFP under the CMV promotor.
• Depositing Lab: Jacco van Rheenen
• Publication: Zomer et al Cell. 2015 May 21;161(5):1046-57. doi: 10.1016/j.cell.2015.04.042.

Backbone

• Vector backbone: pcDNA3.1
• Total vector size (bp): 8225
• Vector type: Mammalian Expression, Cre/Lox
• Selectable markers: Zeocin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: CMV promoter driving CFP expression
• Promoter: CMV

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: Mlul (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: GCT GCT TCG CGA TGT ACG G

Gene/Insert 2

• Gene/Insert name: UBC promoter driving Cre-25nt expression
• Promoter: UBC

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRl (not destroyed)
• 3′ cloning site: Xbal (not destroyed)
• 5′ sequencing primer: GCCACTCCCACTGTCCTTTC

Resource Information

• Supplemental Documents:
  • DNA star Sequence builder file of pcDNA3.1-CFP;Cre25nt;Zeo
• Articles Citing this Plasmid:
  • 5 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry