-
PurposeFunctions as a genetic Cre reporter that switches from DsRed expression to eGFP expression upon presence of Cre recombinase.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 65726 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepLV
- Total vector size (bp) 9997
-
Vector typeMammalian Expression, Lentiviral, Cre/Lox
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLoxP-DsRed-LoxP-eGFP
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Sall (not destroyed)
- 3′ cloning site Spel (not destroyed)
- 5′ sequencing primer cgcaaatgggcggtaggcgtg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Addgene Notes
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLV-CMV-LoxP-DsRed-LoxP-eGFP was a gift from Jacco van Rheenen (Addgene plasmid # 65726 ; http://n2t.net/addgene:65726 ; RRID:Addgene_65726) -
For your References section:
In Vivo imaging reveals extracellular vesicle-mediated phenocopying of metastatic behavior. Zomer A, Maynard C, Verweij FJ, Kamermans A, Schafer R, Beerling E, Schiffelers RM, de Wit E, Berenguer J, Ellenbroek SI, Wurdinger T, Pegtel DM, van Rheenen J. Cell. 2015 May 21;161(5):1046-57. doi: 10.1016/j.cell.2015.04.042. 10.1016/j.cell.2015.04.042 PubMed 26000481